Commit fd0fdb68 authored by Jannes Höpke's avatar Jannes Höpke

Upload New File

parent bf2bc6d2
#NEXUS
[! Generated by PhyDE 0.9971 ]
[Mon Apr 09 17:53:50 BST 2018]
BEGIN DATA;
DIMENSIONS NTAX=82 NCHAR=692;
FORMAT DATATYPE=DNA GAP=- MISSING=? ;
MATRIX
AY101885_Littorella_uniflora_148_United_Kingdom CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGTAGACTTGCGAACACGTGTTTAAC-TGAACGGTGCCCAGACGCGCTAGAGCAA--TC-T-GTGTGT-TGGGGCATTGTGTCCGCCAGGTGCTTGCGCTTGGTGGGCTAACGAAACCCGGCGCGGCCTGCGCCAAGGAAAACTAAAA---TAGAAGCGTCGC-CCCT--GTGACTCCC-GTTCGCGGTGTGGTTGC-GGGGATGCGGCGAATCTCGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCCTTGTGNNTTGGTGA-T-GGGGCGGAAAATGGCNTCCCGTTANCTCGGNTNGCCCAAAAAGGATCCNTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGCNGTTGTGCTTCACCCTGTCGCTTGGTAGGGCATCGTTATAAACCAACGGCGTGTAATGCGCCTTCGACCGCGACCCCAGGTCAGACGGGACTACCCGCTGAGTTTAANCA
AY101876_Plantago_rigida_165_Unknown CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTAAAAAGTAGACCTGTGAACACGTGTTTAACATGAACAGTGGCTCGTTGGGCTGGAGCAA--TC-C-ACTCTT-CGGGACACTGTGCCTGCCCGGTGCTTGCACTTGGTGG?CTAACGAAACCCGGCGCGGCAAGCGTCAAGGAAAACGAAA----TGGAAGCGTTGCTCCCC--GTGACTCCC-GTTTGCGGTGTGGTTTT-GGGGATGTGATGTATCTTGAAAGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCTTCGGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCATACACCAATTT---------GGTGC-T-GGGGCGGATAGTGGCATCCCGTTAGCTCGGTTTGCCCAAAAAGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGATGCCGTTGTGCTTCACTCCGTCGCATTATTGGGCATCGTTACAAAACAACGGTGC-TTACGCACCTTCGACCGCGACCCCAGGTCAGACGGAC????????????????????
AY101861_Plantago_major_163_Germany CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTAAAAAGTAGACCTGTGAACACGTGTTTAACATGAACGTTGCCTCGTTGGGCTGGAGCAA--TC-C-ACTCTT-CGTGACACCGTGCCTGCCCGGTGCTTGCACTTGGTGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAAAA----TGGAAGCGTTGCTCCCC--GTGACTCCC-GTTCGCGGTGTGGTTTT-GGGGATGTGATGTATCTTGAAAGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTACACCAATTT---------GGTGC-G-GGGGCGGATAATGGCATCCCGTTAGCTCGGTTTGCCCAAAAAGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGCCGTTGTGCTTCACTCCGTCGCATGCTTGGGCATCGTTACAAAACAATGGTGC-TANCGCGCCTTCGACCGCGACCCCAGGTCAGACGGGACTACCCGCTGAGTTTAAGCA
AJ548971_Plantago_camtschatica_162_Unknown CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTAAAAAGTAGACCTGTGAACACGTGTTTAACATGAACGGTGCCTCGTTGGGTTAGAGCAA--TC-C-ACTCTT-CGGGACACTGTGCCTACCTGGTGCTTGCACTTGGTGGGCTAACGAAACCCGGCGCGGCAAGTGCCAAGGAAAACAAAA----TGGAAGCGTTGCTCCCC--TTGACTCCC-GTTCGCGGAGTGGTTTT-GGGGAAGTGATGTATCTTGAAAGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTATACCAATTT---------GGTGCGGGGGGGCGGATAATGGCATCCCGTTAGCTTGGTTTGCCCAAAAAGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGTTGTTGTGCATCACTCTGTCGCATGCTTGGGCATCGTTATAAAACAATGGTGC-TAACGCGCCTTCGACCGCGACCCCAGGTCAGACGGGACTACCCGCTGAGTTTAAGCA
AY101863_Plantago_rugelii_166_Canada CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTAAAAAGTAGACCTGTGAACACGTGTTTAACATGAACGGTGCCTCGTTGGGTTAGAGCAA--TC-C-ACTCTT-CGGGACACCGTGCCTACCCGGTGCTTGCACTTGGTGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAAAA----TGGAAGCGTTGCTCCCC--GTGACTCCC-GTTTGCGGTGTGGTTTT-GGGGATGTGATGTATCTTGAAAGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTATACCAATTT---------AGTGC-G-GGGGCGGATAATGGCATCCCGTTAGCTCGGTTTGCACAAAAAAGATCCCGCATCGACGGATGTCACAACTAGTGGTGGTTG--AAAGATCATTCGTGTCGTTGTGCGTCACTCTGTCGCATGCTTGGGCATCGTTATAAAACAATGGTGC-TAACGTGCCTTCGACCGCGACCCCAGGTCAGACGGGACTACCCGCTGAGTTTAAGCA
AY101865_Plantago_media_164_Unknown CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTAAAAAGTAGACCTGTGAACACGTGNTTAACATGAACGATGTCTCGTCGGGCTGGAGCAA--TC-C-ACTCTT-CGGGNCACCGTGCTTGCCCGGTGCTTGCACTTGGTGGGCTAACGAAACCCGGCGCAGCAAGCGCCAAGGAAAACAAAA----TGGAAGCGTTACTCCTC--TTAACTCCC-GTTCGCGGTGTGGTTTT-GGGGATGTGATGTATCTTGAAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCC-ACACCAATTTT--------GGTGC---GGGGCGGATAATGGCATCCCGTTAGCTCGGTTTGCCCAAAAATGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGTCGTTGTGCTTCACTCTGTCGCATGCTTGGGCATCGTAATAAAACAATGGTGC-TAACGCGCCTTCGACCGCGACCCCAGGTCAGACGGGACTACCCGCTGAGTTTAAGCA
AY101870_Plantago_stauntonii_167_France CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTAAAAAGTAGACCTGTGAACACGTGTTTAACATGAACGGTGCCTCGTCGGGTTGGAGCAA--TC-C-ACTCTT-CGGGACACCGTGCCTGCCCGGTGCTTGCACTTGGTGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAAAAAA--TGGAAGCGTTGCTCCCC--TTGACTCCC-GTTCGCGGTGTTGTTTT-GGGGATGTGATGTATCTTGAAAGTCATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTATACCAATTT---------GGTGT-G-GGGGCGGACAATGGCATCCCGTTAGCTCGGTTTGCCCAAAAAGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGCCGTTGTGCTTCACTCCGTCGCATGCTCGGGTATCGTTATAAGACAATGGTGC-TAATGCGCCTTCGACCGAGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
AY101900_Plantago_amplexicaulis_149_Unknown CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTGAAAAGTAGACCTGTGAACACGTGTTTAACATGAACGGTGCCTCGTTGGGCTGGAGTGA--TC-TTGC-TTGGCGAGGTGCTGTGCTTGCCTGGTGCTAGCACCTGGTGGGCTAACGAACCCCGGCGCGGCAAGCGCCAAGGAAAACAAAT----TAGAATCGTTG-CCCCT--GCGGCTCCC-GTTCGCGGTGTGGCTGT-GGGGATGCAGCGTATCTTGAAAGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAACCCGTTGTGGT-TTGGTGA-C-GGGGCGGATAATGGCTTCCCGTTAGCTCGGTTAGCCTAAAAGAGTTCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGTCGTTGTGCTTCACCCTGTCGATTGCTAGGGCGTCATCATAAATCAACGGCGTGTAATGCGCCTTCGACCGCGACCCCAGGTCAGACGGGACTACCCGCTGAGTTTAAGCA
AY101887_Plantago_webbii_161_Unknown CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTGAAAAGTAGACCTGTGAACATGTGTTTAACATGAACGGTGCCTCGTTGGGATAGAGTAA--TC-T-GTCCTG-CGAGTTGCCGTGCCTACTCGGTGCTAGCACTCGGTGGGCTAACGAAACCCGGCGCGGTAAGCGTCAAGGAAAACATAAA---CAGAATCGATG-CCCCT--ATGGCTCCC-GTCCGCGGTGTGGCTGT-GGGGATGCATCGTATCTTGAAAGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTCCGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGG-ATGGTGA-T-GGGGCGGATAGTGGCTTCCCGTTAGCTCGGTTAGCCCAAATGGGATCCCTCATAGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGCTGTTGTGCTTCACCCTGTCGCTTGTTCGGGAATCGTCATAAACCAACGGCGTGTAATGCGCCTTCGACCGCGACCCCAGGTCAGACGGGACTACCCGCTGAGTTTAAGCA
AY101890_Plantago_mauretanica_157_Unknown CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTGAAAAGTAGACCTGTGAACACGTGTTTAACATGAACGGTGCCTCGTTGGGCTAGAGTAA--TC-T-GTCCTG-CGAGTCGCCGTGCCCACCCGGTGCTAGCACTCGGTGGGCTAACGAAACCCGGCGCGGTAAGCGTCAAGGAAAACAAAAA---CAGAATCGATG-TCCCT--ATGGCTCCC-GTCCGCGGTGTGGCTGT-GGGGATGCATCGTATCTTGAAAGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTCCGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGG-CTGGTGA-T-GGGGCGGATACTGGCTTCCCGTTATCTCGGTTAGCCCAAATGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGCTGTTGTGCTTCACCCTGTCGCTTGTTCGGGCATCGTCATAAACCAACGGCGTGTAATGCGCCTTCGACCGCGACCCCAGGTCAGACGGGACTACCCGCTGAGTTTAAGCA
AY101886_Plantago_arenaria_150_Unknown CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTGAAAAGTAGACCTGTGAACACGTGATTAACATGAACGGCGCCTCGTTGGGCCAGAGTGA--TC-T-GCCCTG-CGAGTCGCCGTGCCTACCCGGTGCTAGCACCTGGTGGGCTAACGAAACCCGGCGCGGCAAGCGTCAAGGAAAACAAAAA---CAGAATCGATG-CCCCCAATTGGCTCCC-GTTCGCGGTGTGGCTGT-TGTGATGCATCGTATCTTGAAAGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCTCCCGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATACCTTGAGGT-CCTGTGA-G-GGGGCGGATATTGGCTTTCCGTTAGCCCGGTTAGCCCAAATGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGCTGTTGTGCTTCACCCTGTCGCTTGTTCGGGAATCGTCATGAACCAACGGCGTGTAAAGCGCCTTCGACCGCGACCCCAGGTCAGACGGGACTACCCGCTGAGTTTAAGCA
AY101892_Plantago_afra_168_Unknown CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTGAAAAGTAGACCTGTGAACACGTGTTTAACATGAACGGTGCCTTGTTGGGCTAGAGTGA--TC-T-GCCCTT-CGAGTCGCCGTGCCCACCCGGTGCTAGCACTCGGTGGGCTAACGAAACCCGGCGCGGTAAGCGTCAAGGAAAACAAAAA---CAGAATCGATG-CCCCT--ATGGCTCCC-GTCCGCGGTGTGGCTGT-GGGGATGCGTCGTATCTTGAAAGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTCCCGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTTGTGGT-ATGGTGA-T-GGGGCGGACATTGGCTTCCCGTTAGCTCGGTTAGCCCAAATGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGTTGTTGTGCTTCACCCTGTCGCTTGTTCGGGCATCGTCATAAACCAACGGCGTGTAAAGCGCCTTCGACCGCGACCCCAGGTCAGACGGGACTACCCGCTGAGTTTAAGCA
AY101908_Plantago_brasiliensis_160_Argentina CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGA-ATCTGAAAAGTAGACCAGCGAACACGTGTTTAACATGAACGGTGCCTCGGTGGGACAGAGTCA--TC-T-TC-CCAGCGGGTCGCCGTGCCTTCCCGGTGCTTGCACCTCGAGGGCTAACGAACCCCGGCGCGGCCAGCGCCAAGGAAAACAAAATA--CAGAATCGTTG-CCCCT--ACGGCCCCC-GTCCGCGGAGTGGTTTGTGGGGATGCAGCGTATCTTGAAAGTCATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAGCCCCTTGTGGA-TTGGTGA-T-GGGGCGGAAAATGGCTTCCCGTTGTCTCGGCTAGCCCAAAAAGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGCCGTTGTGCTTCACCCTGTCGCTTGGTAGGGCATCGTCACAAACCAACGGCGTGTAATGCGCCTTCGACCGCGACCCCAGGTCAGACGGGACTACCCGCTGAGTTTAAGCA
AY101909_Plantago_erecta_154_USA CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTGAAAAGTAGACCAGCGAACACGTGTTTAACATGAACGGCGCCTCGGTGGGACGGAGTCACATC-T-GC-CCAGCGGGTCGCNGTGCCTTCCCGGTGCTTGCACCTCGAGGGCTAACGAACCCCGGCGCGGCCAGCGCCAAGGAAAACAAAAAAAACAGAATCGTTG-CCCCT--ACAGCCCCCCGTCCGCGGGGTGGCCGT-GGGGATGCAGCGTATCTTGAAAGTCATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAGCCCCTTGTGGA-TTGGTGA-T-GGGGCGGAAAATGGCTTCCCGTTGTCTCGGCTAGCCCAAAAAGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGCCGTTGTGCTTCACCCTGTCGCTTGGTAGGGCATCGTCATAAACCAACGGCGTGTAATGCGCCTTCGACCGCGACCCCAGGTCAGACGGGACTACCCGCTGAGTTTAAGCA
AY101891_Plantago_aristata_151_USA CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGA-ATCTGAAAAGTAGACCAGCGAACACGTGTTTAACATGAACGGCGCCTCGGTGGGACGGANTCG--TC-T-GCCCCAGCGGGTCGCCGTGCCTTCCCGGTGCTTGCACCCCGAGGGCTAACGAACCCCGGCGCGGCCAGCGCCAAGGAAAACAAAAAA--CAGAATCGTTG-CCCCT--ACGGTCCCC-GTCCGCGGAGNGGCCGT-GGGGATGCAGCGTATCTTGAAAGTCATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAGCCCCCCGTGGA-CTGGTGA-T-GGGGCGGAAAATGGCTTCCCGTTGTCTCGGCTAGCCCAAAAAGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGCCGTTGTGCTTCACCCTGTCGCTTGGTAGGGCATCGNCACAAACCAACGGCGTGTAACGCGCCTTCGACCGCGACCCCAGGTCAGACGGGACTACCCGCTGAGTTTAAGCA
AY101912_Plantago_patagonica_159_Unknown CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGA-ATCTGAAAAGTAGACCAGCGAACACGTGTTTAACTTGAACGGCGCCCCGGTGGGACGGATTCG--TC-T-GCCCCAGCGGGTCGCCGTGCCTTCCCGGTGCTTGCACCCCGAGGGCTAACGAACCCCGGCGCGGCCAGCGCCAAGGAAAACAAAAAA--CAGAATCGTTG-CCCCT--ACAGTCCCCCGTCCGCGGAGTGGCTGT-GGGGATGCANNGTATCTTGAAAGTCATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCNTGGGCGTCACGCATCGAGTCGCCCCCTCCCAGCCCCTCGTGGA-CTGGTGA-T-GGGGCGGAAAATGGCTTCCCGTTGTCTCGGCTAGCCCAAAAAGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGCCGTTGTGCTTCACCCTGTCGCTTGGTAGGGCATCGTCATAAACCAACGGCGTGTAATGCGCCTTCGACCGCGACCCCAGGTCAGACGGGACTACCCGCTGAGTTTAAGCA
AY101901_Plantago_cretica_153_Cyprus CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCT--AAAGTAGACCTGTGAACACGTGTTTAACATGAACGGCGACCCGCTTGGATAGAGTCCGCTC-T-GCCCTTGCGAGTTGCCGTGCCTTCCCGGTGCTTGCACTTGGAGGGCTAACGAAACCCGGCGCGGCCAGCGCCAAGGAAAACAAAAA---CAGAATCGTTG-CCCCT--ACGGCTCCC-GTCTGCGGTGTGGCTGT-GGGGAAGCAGCGTATCTTGAAAGTCATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAACCCCTTGGGGA-CTGGTGA-T-GGGGCGGAAAATGGCTTCCCGTTTTCTCGGCTAGCCCAAAAAGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGCCGTTGTGCTTCACCCTGTCGCTTGGTAGGGCATCGTCATAAACCAACGGCGTGTAATGCGCCTTCGACCGCGACCCCAGGTCAGACGGGACTACCCGCTGAGTTTAAGCA
AY101897_Plantago_lagopus_155_Unknown CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGTAGACCCGTGAACACGTGTTTAACATGAACGGTGCTTCGTCATGCCTGAGCAA--TC-TTGC-TTGGCGGGGTGCTGTGCTTGCCTGGTGCTTGCACTAGGTGGGCTAACGAATCCCGGCGCGGCAAGCGCCAAGGAAAACAAAAA---TAGAATTGTTG-CCCCT--TTGGCTCCC-GTNCGCGGTGTGGCCAT-GGGGATGCAGCGTATCTTGAAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCTACCATTCCCTCAAAGGTTTGGTTA-T-GGGACGGATAATGGCTTCCCGTTAGCTCGGTTAGCCCAAAAAGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGCTGTTGTGCTTCACCCTGTCGCTTGCTAGGGCATCGTCATAAACTAATGGCGCGTAATGCGCCTTCGACCGCGACCCCAGGTCAGACGGGACTACCCGCTGAGTTTAAGCA
AY101895_Plantago_atrata_152_Unknown CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTGAAAAGTAGACCTGTGAACACGTGTTTAACATGAACGGTGCTTCGTCAGGCCAGAGCAA--TCTTTGC-TTGGCGGGGTGCTGTGCCTGCTCGGTGCTTGCACTGGGTGGGCTAACGAAACCCGGCGCGGAAAGCGCCAAGGAAAACAAAAA---TAGAATCGTTG-CCCCT--GTGGCTCCC-GTACGCGGTGTGGCTAT-GGGGATGCAGCGTATCTTGAAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTTGTGTT-TTGGTGA-T-GGGGCGGATAATGGCTTCCCGTTAGCTCGGTTAGCCCAAAAAGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGCTGTTGTGCTTCACCCTGTCGCTTGCTTGGGCATCGTTAGAAACAAATGACGTGTAATGCGTCTTCGACCGCGACCCCAGGTCAGACGGGACTACCCGCTGAGTTTAAGCA
MH158570_Plantago_cafra_1_South_Africa CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTGAAAAGTAGACCTGTGAACACGTGTTTACCATGAACGGTGCTTCGTCTTGACAGAGCAA--TC-TTGC-TTGGCGGGGTGCTGTGCCTGCCTGGTGCTTGCACTGGGTGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAAAAA---TAGAATTGTTG-CCCCT--GTGGCTCCC-GTACGCGGTGTGGCTAT-GGGGATGCAGCGTATCTTGAAAGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCTTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCATTCCCTTGTGTT-TTGGTGA-T-GGGGCGGATAATGGCTTCCCGTTAGCTCGGTTAGCCCAAAAAGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGCTGTTGTGCTTCACCCTGTCGCTTGCTTGGGCATCGTTAGAAACCAATGACGTGTAATGCGTCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158573_Plantago_cafra_4_South_Africa CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTGAAAAGTAGACCTGTGAACACGTGTTTAGCATGAACGGTGCTTCGTCTTGACAGAGCAA--TC-TTGC-TTGGCGGGGTGCTGTGCCTGCCTGGTGCTTGCACTGGGTGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAAAAA---TAGAATTGTTG-CCCCT--GTGGCTCCC-GTACGCGGTGTGGCTAT-GGGGATGCAGCGTATCTTGAAAGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCTTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCATTCCCTTGTGTT-TTGGTGA-T-GGGGCGGATAATGGCTTCCCGTTAGCTCGGTTAGCCCAAAAAGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGCTGTTGTGCTTCACCCTGTCGCTTGCTTGGGCATCGTTAGAAACCAATGACGTGTAATGCGTCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158572_Plantago_cafra_3_South_Africa CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTGAAAAGTAGACCTGTGAACACGTGTTTAGCATGAACGGTGCTTCGTCTTGACAGAGCAA--TC-TTGC-TTGGCGGGGTGCTGTGCCTGCCTGGTGCTTGCACTGGGTGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAAAAA---TAGAATTGTTG-CCCCT--GTGGCTCCC-GTACGCGGTGTGGCTAT-GGGGATGCAGCGTATCTTGAAAGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCTTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCATTCCCTTGTGTT-TTGGTGA-T-GGGGCGGATAATGGCTTCCCGTTAGCTCGGTTAGCCCAAAAAGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGCTGTTGTGCTTCACCCTGTCGCTTGCTTGGGCATCGTTAGAAACCAATGACGTGTAATGCGTCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158571_Plantago_cafra_2_South_Africa CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTGAAAAGTAGACCTGTGAACACGTGTTTACCATGAACGGTGCTTCGTCTTGACAGAGCAA--TC-TTGC-TTGGCGGGGTGCTGTGCCTGCCTGGTGCTTGCACTGGGTGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAAAAA---TAGAATTGTTG-CCCCT--GTGGCTCCC-GTACGCGGTGTGGCTAT-GGGGATGCAGCGTATCTTGAAAGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCTTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCATTCCATTGTGTT-TTGGTGA-T-GGGGCGGATAATGGCTTCCCGTTAGCTCGGTTAGCCCAAAAAGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGCTGTTGTGCTTCACCCTGTCGCTTGCTTGGGCATCGTTAGAAACCAATGACGTGTAATGCGTCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
AY101896_Plantago_nivalis_158_Spain CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTGAAAAGTAGACCTGTGAACACGTGTTTAACATGAACGGTGCTCCGTCAGGCCCGAGCAA--TC-TTGC-TTGGCGTGGTGCTGTGCCTGCCCGGTGCTTGCACTGGGTGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATAA---TAGAATCGTTG-CCCCC--GTGGCTCCC-GTACGCGGNGTGGCTAT-GGGGATGCAGCGTATCTTGAAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTCCGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTTGTGTT-TTGGTGA-T-GGGGCGGATAATGGCTTCCCGTTAGCTCGGTTAGCCCAAAAAGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGCTGTTGTGCTTCACCCTGTCGCTTGCTTGGGCATCGTTAGAAACAAATGACGTGTAATGCGTCTTCGACCGCGACCCCAGGTCAGACGGGACTACCCGCTGAGTTTAAGCA
AY101898_Plantago_lanceolata_156_Unknown CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGTAGACCTGTGAACACGTGTTTAACATGAACGGTGCTTCGTCATGCTAGAGNAA--TC-TTGC-TTGGCGGGGTGCTGTGCTTGCCCGGTGCTCGCACTAGGTGGGCTAACGAATCCCGGCGCGGCAAGCGCCAAGGAAAACAAAAA---TAGAATCGTTG-CCCCT--TTGGCTCCC-GTCCGCGGTGTGGCCAT-GGGGATGCAGCGTATCTTGAAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGTCCCCTCCCATTCCCTCACGGGTTTGGTTA-T-GGGACGGATAATGGCTTCCCGTTAGCTCGGTTAGCCCAAAAAGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTGGTGCTGTTGTGCTTCACCCTGTCGCTTGCTAGGGCATCGTCATAAACTAACGGCGTGTAATGCGCCTTCGACCGCGACCCCAGGTCAGACGGGACTACCCGCTGAGTTTAAGCA
AY101877_Plantago_alpina_32_Unknown CGTAACAAGGTTCCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTGAAAAGCAAACCCGCGAACACGTTTCTAACATCAACGGTGGCTCGTCGAGCGGGAGAAA--TC-CT-C-TCGCCGAGACGCCGTGTCCGCCCGGTGCTTGCACCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAAAA----CAGAATCGTTGCNCCCC--GCGACTCCC-GTCCGCGGTGTGGTNGT-GGGGATGCGACGTATCTT-TAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAGTCCCTTGCGGA-TAGGCGA-T-GGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAATGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTTGTGCTGTTGTGCTTCACGCTGTCGCTTG-TAGTGGATCGCTCGGAACCAACGGCGTGTCATGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
AY101879_Plantago_maritima_64_Unknown CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTGAAAAGCAAACCCGCGAACACGTTTCTAACATCAACGGTGGCTCGTCGAGCGGGAGAAA--TC-CT-C-TCGTCGAGACGCCGTGTCCGCCCGGTGCTTGCNCCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAAAA----CAGAATCGTTGCTCCCC--GCGACNCCC-GTCCGCGGTGTGGTTGT-GGGGATGCGACGTATCTT-TAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAGTCCCTTGCGGA-TAGGTGA-T-GGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAATGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTTGTGCTGTTGTGCTTCACGCTGTCGCTTG-TGGTGGATCGCTCGGAACCAACGGCGTGTCATGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
HQ593837_Plantago_maritima_63_Unknown ?????????GTTTCCTGAGGTGAACCTGCGGAAGGATCATTGTCGATATCTGAAAAGCAAACCCGCGAACACGTTTCTAACATCAACGGTGGCTCGTCGAGCGGGAGAAA--TC-CT-C-TCGYCGAGACGCCGTGTCCGCCCGGTGCTTGCACCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAAAA----CAGAATCGTTGCTCCCC--GCGACTCCC-GTCCGCGGTGTGGTTGT-GGGGATGCGACGTATCTT-TAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAGTCCCTTGCGGA-TAGGYGA-Y-GGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAATGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTTGTGCTGTTGTGCTTCACGCTGTCGCTTG-YTGTGGATCGCTCGGAACCAACGGCGTGTCATGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158574_Plantago_maritima_salsa_62_Russia CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTGAAAAGCAAACCCGCGAACACGTCTCTAACATCAACGGTGGCTCGTCGAGCGGGAGAAA--TC-CT-C-TCGYCGAGAYGCCGTGTCCGCCCGGTGCTTGCACCAGGYGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAAAA----CAGAATCGTCGCGCCCC--GCGACTCCC-GTCCGCGGTGTGGTTGT-GGGGATGCGATGTATCTTTAAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAGTCCCTTGCGGA-TAGGCGA-T-GGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAATGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TGGTGGATCGCTCGGAACCAACGGCGTGTCATGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
AY101878_Plantago_subulata_70_Unknown CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTGAAAAGCAAACCCGCGAACACGTTCCTAACATCAACGGTGGCTCGTCGAGCGGGAGAAA--TC-CT-C-TCGCCGAGACGCCGTGTCCGCCCGGTGCTTGCACCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACNAAA----CAGAATCGTCGCGCCCC--GCGACNCCC-GTCCGCGGTGTGGTCGT-GGGGATGCGACGTATCTT-TAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAGTCCCTTGCGGA-CAGGCGA-T-GGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAATGNGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTTGTGCTGTTGTGCTTCACGCNGTCGCTTG-CNGTGGATCGCTCGGAACCAACGGCGTGTCATGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158575_Plantago_subulata_30_Spain CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTGAAAAGCAAACCCGCGAACACGTCTCTAACATCAACGGTGGCTCGTCGAGCGGGAGAAA--TC-CT-C-TCGCCGAGACGCCGTGTCCGCCCGGTGCTTGCGCCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAAAA----CAGAATCGTCGCGCCCC--GCGACTCCC-GTCCGCGGTGTGGTCGT-GGGGATGCGACGTATCTT-TAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAGTCCCTTGCGGA-TAGGCGA-T-GGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAATGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTG--AAAGATCATTTGTGCTGTTGTGCTTCACGCTGTCGCTTG-TGGTGGATCGCTCGGAACCAACGGCGTGTCATGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158583_Plantago_carnosa_51_South_Africa GGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAA-CCGCGAACACGTGTTTAACATGAACGGTGCCCCGTCGAGCTTGAGAAA--TC-TT-C-TTGGCGAGACGCCGTGTCTGCCCGGTGCTTGCACCAGGCGGGCTAACGAAAACCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACTCCC-GTACGCGGTGTGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCAACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCCCGTGGA-TAGGTGA-T-GGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158577_Plantago_carnosa_22_South_Africa GGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACACGTGTTTAACATGAACGGTGCCCCGTCGAGCTTGAGAAA--TC-TT-C-TTGACGAGACGCCGTGTCCGCCCGGTGCTTGCACCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACTCCC-GTACGCGGTGTGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCACGTCGCCCCCTCCCAATCCCCCGTGGA-TAGGTGT-TGGGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158584_Plantago_carnosa_52_South_Africa ?GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACACGTGTTTAACATGAACGGTGCCCCGTCGAGCTTGAGAAA--TC-TT-C-TTGGCGAGAYGCCGTGTCTGCCCGGTGCTTGCACCAGGTGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGTGCCCC--GTGACTCCC-GTACGCGGTGTGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGATGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGTATCGCGTCGCCCCCTCCCAATCCCCCGTGGA-TAGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCATCGACGGATGTCACAACTAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158578_Plantago_carnosa_23_South_Africa ????ACAAGGTTtCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACACGTGTTTAACATGAACGGTGCCCCGTCGAGCTTGAGAAA--TC-TT-C-TTGACGAGACGCCGTGTCCGCCCGGTGCTTGCACCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACTYCC-GTACGCGGTGTGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCACGTCGCCCCCTCCCAATCCCCCGTGGA-TAGGTGA-TGGGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158579_Plantago_carnosa_24_South_Africa ??TAACAAGGTTTCCGTAGGTGACCCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACACGTGTTTAACATGAACGGTGCCCCGTCGAGCTTGAGAAA--TC-TT-C-TTGACGAGACGCCGTGTCCGCCCGGTGCTTGCACCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCTCCCC--GTGACTCCC-GTACGCGGTGTGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCACGTCGCCCCCTCCCAATCCCCCGTGGA-TAGGTGA-TGGGGGCGTAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TA-GGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGAMGGGATTACCCGCTGAGTTTAAGCA
MH158580_Plantago_carnosa_25_South_Africa GGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACACGTGTTTAACATGAACGGTGCCCCGTCGAGCTTGAGAAA--TC-TT-C-TTGGCGAGACGCCGTGTCTGCACGGTGCTTGCACCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACTCCC-GTACGCGGTGTGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCCCGTGGA-TAGGTGA-T-GGGGCGGAAACTGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158581_Plantago_carnosa_26_South_Africa GGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACACKTGTTTAACATGAACGGTGCCCCGTCGAGCTTGAGAAA--TC-TT-C-TTGACGAGACGCCGTGTCCGCCCGGTGCTTGCACCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACTCCC-GTACGCGGTGTGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCACGTCGCCCCCTCCCAATCCCCCGTGGA-TAGGTGA-TGGGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158582_Plantago_carnosa_27_South_Africa CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACACGTGTTTAACATGAACGGTGCCCCGTCGAGCTTGAGAAA--TC-TT-C-TTGACGAGACGCCGTGTCCGCCCGGTGCTTGCACCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACTCCC-GTACGCGGTGTGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCACGTCGCCCCCTCCCAATCCCCCGTGGA-TAGGTGT-TGGGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAAACGGGATTACCCGCTGAGTTTAAGCA
AF515217_Plantago_coronopus_35_England CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGYGTCCCGTCKAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTTCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????
MH158607_Plantago_crassifolia_54_Spain CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACACGTGTTTAACATGAACGGTGCCCCGTCGAGCTAGAGAAA--TC-TT-C-TTGGCGAGATGCCGTGTCCGCTCGGTGCTTGCACCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCTCCCT--GTGACTCCC-GTCCGCGGTGTGGTTGT-GGGAATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGCGGA-TAGGTGA-T-GGGGCGGAAAATGGCCTCCCGTTTGCTCGGTTGGCCCAAAAGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGCGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
AY101881_Plantago_crassifolia_55_Spain CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTCAAAAGCAAACCCGCGAACACGTGTTTAACATGAACGGTGCCCCGTCGAGCTAGAGAAA--TC-TT-C-TTGGCGAGACGCCGTGTCCGCTCGGTGCTTGCACCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCTCCCT--GTGACTCCC-GTCCGCGGTGTGGTTTT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGCGGA-TAGGTGA-T-GGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGTGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCNAACGGCGTCTAGCGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158593_Plantago_coronopus_19_South_Africa ??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????CTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATAYTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCAAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCC???????????????????????????????????????????????????????????????????????????????????????????????
MH158596_Plantago_coronopus_38_South_Africa GGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGATCCCC-GTCCGCGGTGCGGTTGT-GGGGATGCAACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCAAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
AY101882_Plantago_coronopus_34_Denmark CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTTCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCGAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
HQ593830_Plantago_coronopus_41_Unknown ?????????GTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTTCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCGAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
HQ593832_Plantago_coronopus_42_Unknown ?????????GTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTTCGCGGTGCGGTTGT-GGGGATGYGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCGAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
HQ593833_Plantago_coronopus_40_Unknown ?????????GTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGYGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTTCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCGAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158603_Plantago_coronopus_cupanii_15_Italy CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCTTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACTCCC-GTCCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCCCGTGGA-TCGGTGA-T-GGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCAACGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATT-GTGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158612_Plantago_serraria_47_Malta CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACACGTGTTTAACATGAACGGTGCCCCGTCGAGCTAGAGAAA--TC-TT-C-TTGGCGAGACGCCGTGTCCGCCCGGTGCTTGCACCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCTCCCT--GTGACTCCC-GTCCGCGGTGTGGTTGT-GGGGATGYGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTTGCGGA-TAGGTGA-T-GGGGCGGAAAATGGCCTCCCGTTTGCTCGGTTGGCCCAAAAGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158608_Plantago_crypsoides_14_Iran CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACAAGTGTTTAACATCAACGGCGCCCAGTCGAGCTAGAGAAA--TC-TT-C-TTGGCGAGACGCCGTGTCCGCTCGGTGCTTGCACCGGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCTCCCT--GTGACTCCC-GTCCGCGGTGTGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGCGGA-TAGGTGA-C-GGGGCGGAAAATGGCCTCCCGTTGGCTCGGTTTGCCCAAAAGTGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158594_Plantago_coronopus_20_Spain CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTTCGCGGTGCGGTTGT-GGGGATGTGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCGAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158609_Plantago_crypsoides_16_Kuwait CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACAAGTGTTTAACATGAACGGCGCCCAGTCGAGCTAGAGAAA--TC-TT-C-TTGGCGAGACGCCGTGTCCGCTCGGTGCTTGCACCGGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCTCCCT--GTGACTCCC-GTCCGCGGTGTGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGCGGA-TAGGTGA-C-GGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGTGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTTGCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158611_Plantago_crypsoides_43_Bahrain CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACAAGTGTTTAACATCAACGGCGCCCAGTCGAGCTAGAGAAA--TC-TT-C-TTGGCGAGACGCCGTGTCCGCTCGGTGCTTGCACCGGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCTCCCT--GTGACTCCC-GTCCGCGGTGTGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGCGGA-TAGGTGA-C-GGGGCGGAAAATGGCCTCCCGTTGGCTCGGTTTGCCCAAAAGTGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158592_Plantago_coronopus_17_Montenegro CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTTCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCGAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158610_Plantago_crypsoides_18_Saudi_Arabia CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACAAGTGTTTAACATGAACGGCGCCCAGTCGAGCTAGAGAAA--TC-TT-C-TTGGCGAGACGCCGTGTCCGCTCGGTGCTTGCACCGGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCTCCCT--GTGACTCCC-GTCCGCGGTGTGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGCGGA-TAGGTGA-C-GGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGTGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158587_Plantago_coronopus_5_Algeria CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTTCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCGAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158602_Plantago_coronopus_cupanii_6_Algeria CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCTTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACTCCC-GTCCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCCCGTGGA-TCGGTGA-T-GGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCAACGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATT-GTGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158595_Plantago_coronopus_36_Morocco CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACTCCC-GTCCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-Y-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCAAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158604_Plantago_coronopus_macrorhiza_11_Tunisia CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGGGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTTCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCAAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158597_Plantago_coronopus_39_Turkey CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAATCCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTCCGCGGTGCGGTTGT-GGGGATGCAACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCAAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTNNNNNNNN---NNNCATCGTTTTAACCCAACGGCGTCTAGTGCGCC-TCGACCGCGACCCCA????????????????????????????????
MH158590_Plantago_coronopus_9_Spain CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGYGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAAHGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTTCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAKCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCGAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TARGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158588_Plantago_coronopus_7_South_Africa GGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTCCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCAAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158591_Plantago_coronopus_10_Spain CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTTCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCGAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
HQ593835_Plantago_coronopus_macrorhiza_60_Unknown ?????????GTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGGGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTTCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCAAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
HQ593834_Plantago_coronopus_macrorhiza_59_Unknown ?????????GTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGYGRGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTTCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCRAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
AY101883_Plantago_coronopus_macrorhiza_61_Unknown CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGGGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTTCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCAAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
AY101880_Plantago_serraria_68_Unknown GGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACACGTGTTTAACATGAACGGNGCCCCGTCGAGCTAGAGAAA--TC-TT-C-TTGGCGAGACGCCGTGTCCGCNCGGTGCTTGCACCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCTCCCT--GTGACTCCC-GTCCGCGGTGTGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTTGCGGA-TAGGTGA-T-GGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCCAACGGCGTGTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158613_Plantago_serraria_66_Italy ????????????????????????????????AGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACACGTGTTTAACATGAACGGNGCCCCGTCGAGCTAGAGAAA--TC-TT-C-TTGGCGAGACGCCGTGTCCGCCCGGTGCTTGCACCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCTCCCT--GTGACTCCC-GTCCGCGGTGTGGTTGT-GGGGATGTGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTTGCGGA-TAGGTGA-T-GGGGCGGAAAATGGCCTCCCGTTTGCTCGGTTGGCCCAAAAGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
AY101884_Plantago_coronopus_subspathulata_69_Portugal CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCTCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACTCCC-GTCCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCAAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158585_Plantago_carnosa_144_South_Africa ???????????????????????????????????????TTGTCGATATCTTAAAAGCAAACC?GCGAACACGTGTTTAACATGAACGGTGCCCCGTCGAGCTTGAGAAA--TC-TT-C-TTGGCGAGATGCCGTGTCTGCCCGGTGCTTGCACCAGGCGGGCTAACGAAAACCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACTCCC-GTACGCGGTGTGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCAACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCCCGTGGA-TAGGTGA-T-GGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCC?????????????????????????????????
MH158601_Plantago_coronopus_145_South_Africa ????????????????????????????????????????TGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTCCGCGGTGCGGTTGT-GGGGATGCAACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCAAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTA????
MH158589_Plantago_coronopus_8_South_Africa ???????????????????????????????????????TTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGATCCCC-GTCCGCGGTGCGGTTGT-GGGGATGCAACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCAAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158598_Plantago_coronopus_44_Iran ??TAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTCCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCAAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
KF815505_Plantago_coronopus_37_Saudi_Arabia ???????????????????????????????AATG----TT--CG--ATCTT--AAGC-AACCCGCGGACTCGTGTTTA-CATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTCCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCAAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158599_Plantago_coronopus_48_Portugal CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGCTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTTCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCGAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158600_Plantago_coronopus_49_Portugal CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACTCGTGTTTAACATGAACGGCGTCCCGTCGAGMTTGAGTAA--TC-TT-C-TTGGCGAGACGACGTGTCCGCCTGGTGCTTGCACCAGGCTGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACCCCC-GTTCGCGGTGCGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGTGGA-TCGGTGA-T-GGGACGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCGAAGACGGATGTCACAACCAGTGGTGGTTG-AAAATATCATTT-TGCTGTTGTGCTTCACCCTGTCTCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158606_Plantago_crassifolia_53_Spain CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACACGTGTTTAACATGAACGGTGCCCCGTCGAGCTAGAGAAA--TC-TT-C-TwGGCGAGATGCCGTGTCCGCTCGGTGCTTGCACCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCTCCCT--GTGACTCCC-GTCCGCGGTGTGGTTGT-GGGAATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGCGGA-TAGGTGA-T-GGGGCGGAAAATGGCCTCCCGTTTGCTCGGTTGGCCCAAAAGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGCGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158605_Plantago_crassifolia_50_Greece CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACACGTGTTTAACATGAACGGTGCCCCGTCGAGCTAGAGAAA--TC-TT-C-TTGGCGAGATGCCGTGTCCGCTCGGTGCTTGCACCAGGCGGGCTAACGAAACCCGGCGCGGAAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCTCCCT--GTGACTCCC-GTCCGCGGTGTGGTTGT-GGGAATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCTCGCGGA-TAGGTGA-T-GGGGCGGAAAATGGCCTCCCGTTTGCTCGGTTGGCCCAAAAGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCCAACGGCGTCTAGCGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGA?????????
MH158576_Plantago_crassifolia_21_South_Africa CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAA-CCGCGAACACGTGTTTAACATGAACGGTGACCCGTCGAGCTTGAGAAA--TC-TT-C-TTGGCGAGATGCCGTGTCTGCCCGGTGCTTGCACCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCGCCCC--GTGACTCCC-GTACGCGGTGTGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCCCGTGGA-TAGGTGA-T-GGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCCAATGGTGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGACGGGATTACCCGCTGAGTTTAAGCA
MH158586_Plantago_carnosa_146_South_Africa CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGATATCTTAAAAGCAAACCCGCGAACACKTGTTTAACATGAACGGTGCCCCGTCGAGCTTGAGAAA--TC-TT-C-TTGGCGAGACGCCGTGTCTGCCCGGTGCTTGCACCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGYTGCGCCCC--GTGACTCCC-GTACGCGGTGTGGTTGT-GGGGATGCGACGTATCTTACAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCCTCCCAATCCCCCGTGGA-TAGGTGA-T-GGGGCGGAAACTGGCCTCCCGTTAGCTCGGTTGGCCCAAAAGGGATCCCTCATCGACGGATGTCACAACCAGTGGTGGTTGAAAAATATCATTTGTGCTGTTGTGCTTCACCCTGTCGCTTG-TAGGGCATCGTTTTAACCCAACRGCGTCTAGTGCGCCTTCGACCGCGACCCCAGGTCAGA?????????????????????????
MH158614_Plantago_carnosa_147_South_Africa ????????????????????????????????????????TGTCGATATCTTAAAAGCAAACCCGCGAACACGTGTTTAACATGAACGGNGCCCCGTCGAGCTTGAGAAA--TC-TT-C-TTGACGAGACGCCGTGTCCGCCCGGTGCTTGCACCAGGCGGGCTAACGAAACCCGGCGCGGCAAGCGCCAAGGAAAACAATA----CGGAATCGTTGCKCCCC--GTGACTCCC-GTACGCGGTGTGGTTGT-GGGGATGCGACGTATCTTATAAGTCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAKAATCCCGTGAACCATCGAATCTTTGAACGCAAGTTGCGCCCGACGCCTTCGGGCTGAGGGCACGCCTGCCTGGGCGTCACGCATCACGTCGCCCCCTCCCAATCCCCCGTGGA-TAGGTGN-TGGGGGCGGAAAATGGCCTCCCGTTAGCTCGGTTGG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????
;
END;
[End of File]
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment